View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9116_low_9 (Length: 291)
Name: NF9116_low_9
Description: NF9116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9116_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 270
Target Start/End: Original strand, 3566841 - 3567101
Alignment:
| Q |
11 |
tggtgttgaatacacttgggccaatggtaagggaatcaatataagcacataaagaaggttgaatagagacatcactaatcaatcatggttagattcttgt |
110 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3566841 |
tggtgttgaatacacttgagccaatggtaagggaatcaatataagcacataaagaaggttggatagagacatcactaatcagtcatggttagattcttgt |
3566940 |
T |
 |
| Q |
111 |
cattcccttacattatcaaccctcacaaaacatcattct-gacaactaatctcttttgctagatgttcaagttaataacatactttttgcttctcagttc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3566941 |
cattcccttacattatcaaccctcacaaaacatcattctagacaactaatctcttttgctagatgttcaagttaataacatactttttgcttctcagttc |
3567040 |
T |
 |
| Q |
210 |
aaattcatgagaatgtgggtttctcatcctgattgttccacaattgttagagatagctgga |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3567041 |
aaattcatgagaatgtgggtttctcatcctgattgttccacaattgttagagatagctgga |
3567101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University