View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9118_low_22 (Length: 262)
Name: NF9118_low_22
Description: NF9118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9118_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 43550442 - 43550679
Alignment:
| Q |
18 |
ccccatccaattgtaggaactttgatatgttcttcacacgttgcagcactactgttacaagcttgtagaattagggatttgcttacaattccctttttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43550442 |
ccccatccaattgtaggaactttgatatgttcttcacacgttgcagcactactgctacaagcttgtagaattagggatttgcttacaattccctttttct |
43550541 |
T |
 |
| Q |
118 |
taactacacgtgggcttggcccaattaaatcaagtaatcaacacacaaacacccaacaaatctttccctgatgactcaagtgaaaccaacttcatctcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43550542 |
taactacacgtgggcttggcccaattaaatcaagtaatcaacacacaaacacccaacaaatctttccctgatgactcaagtgaaaccaacttcatctcca |
43550641 |
T |
 |
| Q |
218 |
acgcctctcgtatacaatgataccgcatctctctgctt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43550642 |
acgcctctcgtatacaatgataccgcatctctatgctt |
43550679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 116
Target Start/End: Complemental strand, 17738140 - 17738042
Alignment:
| Q |
18 |
ccccatccaattgtaggaactttgatatgttcttcacacgttgcagcactactgttacaagcttgtagaattagggatttgcttacaattccctttttc |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
17738140 |
ccccatccaattgtaggaactctgatatgttcttcacacgttgcagcactactgttacaagcttgtagaattagggatttgattttaattccctttttc |
17738042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 192 - 244
Target Start/End: Complemental strand, 17737871 - 17737819
Alignment:
| Q |
192 |
ctcaagtgaaaccaacttcatctccaacgcctctcgtatacaatgataccgca |
244 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17737871 |
ctcaagtgaacacaacttcatctccaacgcctcttgtatacaatgataccgca |
17737819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University