View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9118_low_27 (Length: 236)
Name: NF9118_low_27
Description: NF9118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9118_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 11 - 222
Target Start/End: Complemental strand, 17998347 - 17998130
Alignment:
| Q |
11 |
tggtgttgaatgtatgtgacaattatgaaatggttttaatgcattgatgtatttataggaaaatttg-atgtagaagactaaaaggc-aaagtatcgtaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
17998347 |
tggtgttgaatgtatgtgacaattatgaaatggttttaatgcattgatgtatttataggaaaatttgaatgtagaagactaaaaggcaaaagtatcgtaa |
17998248 |
T |
 |
| Q |
109 |
tgggatatgcttaccaatattatttggttttcgtgtggaaccgt----tacatatttgattatgacatgtcggtgcttctttattaactaagcatgttat |
204 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17998247 |
tgggatatgcttagcaatattatttggttttcgtgtgtaaccgttgcatacatatttgattatgacatgtcggtgcttcttttttaactaagcatgttat |
17998148 |
T |
 |
| Q |
205 |
catgataagaaagaattg |
222 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
17998147 |
cataataagaaagaattg |
17998130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 11 - 71
Target Start/End: Complemental strand, 18005698 - 18005638
Alignment:
| Q |
11 |
tggtgttgaatgtatgtgacaattatgaaatggttttaatgcattgatgtatttataggaa |
71 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
18005698 |
tggtgttgagtgtatgtgatgattatgaaatgatcttaatgcattgatgtatttataggaa |
18005638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University