View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9119_low_48 (Length: 260)
Name: NF9119_low_48
Description: NF9119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9119_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 1108686 - 1108866
Alignment:
| Q |
15 |
gaggacttgattaattagattaagttcttaattagttgattcagatttaaaggaatttagagtattagttttgtaattcaaataaacaataagtggttag |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1108686 |
gaggacatgattaattagattaagttcttaattagttgattcagatttaaaggaatttagagtattagttttgtaattcaaa----caataagtggttag |
1108781 |
T |
 |
| Q |
115 |
tttgtttgtttcttaagctacaagttagctaataagttgagaaaagttagttatagattaacttgattacggggttacttgatag |
199 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
1108782 |
ttagtttgtttcttaagctacaagttagctaataagttgagaaaagttagtgatagattaacttgattacagggttacttgatag |
1108866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University