View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9119_low_51 (Length: 246)
Name: NF9119_low_51
Description: NF9119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9119_low_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 20 - 231
Target Start/End: Complemental strand, 43008421 - 43008210
Alignment:
| Q |
20 |
ttccaacatactcttttttccgcatagttcatctttaaggatatttctttctttttcttgacaagtttaaggatattgcttaaatagtacaattcttggt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008421 |
ttccaacatactcttttttccgcatagttcatctttaaggatatttctttctttttcttgacaagtttaaggatattgcttaaatagtacaattcttggt |
43008322 |
T |
 |
| Q |
120 |
acgggtggatatgtatattcgagataacaaattttgaagatttggctatttcatcttagtattttttatcagaattacaacttagtttatttggcaacaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008321 |
acgggtggatatgtatattcgagataacaaattttgaagatttggctatttcatcttagtattttttatcagaattacaacttagtttatttggcaacaa |
43008222 |
T |
 |
| Q |
220 |
ttcttctagcac |
231 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43008221 |
ttcttctagcac |
43008210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University