View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9119_low_53 (Length: 240)
Name: NF9119_low_53
Description: NF9119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9119_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 42754849 - 42754640
Alignment:
| Q |
18 |
agagaatctatctgaattgtggacaattgggtctcacccctcctacttctactacaccccatagctctacacattcatgtaataagcgtccttcaaggtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42754849 |
agagaatctatctgaattgtggacaattgggtctcacccctcctacttctactacaccccatagctctacacattcatgtaataagcgtccttcacggtt |
42754750 |
T |
 |
| Q |
118 |
catgatatttgcttcttcatggcttccaaattatgcttctcttaacaataccttcattgcttctgcttcttcttccctcggtggttcaggtcctcactct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42754749 |
catgatatttgcttcttcatggcttccaaattatgcttctcttaacaacaccttcattgcttctgcttcctcttccctcggtggttcaggtcctcactct |
42754650 |
T |
 |
| Q |
218 |
tcttctatct |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
42754649 |
tcttctatct |
42754640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University