View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9119_low_54 (Length: 240)

Name: NF9119_low_54
Description: NF9119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9119_low_54
NF9119_low_54
[»] chr2 (1 HSPs)
chr2 (1-223)||(3361193-3361411)


Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3361411 - 3361193
Alignment:
1 cctgaaatttgttgtagtgctttgaccaaaagaatcgaccaacttgacgctgcagtcaccactttaaagagtgatcataccgattatgtagcgatgcagg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
3361411 cctgaaatttgttgtagtgctttgaccaaaagaatcgaccaacttgacgctgcggtcaccactttaaagagtgatcataccgattatgtagcgatgcagg 3361312  T
101 tcctattgcatagtaaacctgctgagacacttcatgaaataatgaaggctttacttgaagatcatcggcaagattctcatggcaaggtttggctttaatt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    ||    
3361311 tcctattgcatagtaaacctgctgagacacttcatgaaataatgaaggctttacttgaagatcatcggcaagattcacatggcaaggtttggct----tt 3361216  T
201 acatgaagttcagtgctttagat 223  Q
    |||||||||||||||||||||||    
3361215 acatgaagttcagtgctttagat 3361193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University