View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9119_low_57 (Length: 240)
Name: NF9119_low_57
Description: NF9119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9119_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3361411 - 3361193
Alignment:
| Q |
1 |
cctgaaatttgttgtagtgctttgaccaaaagaatcgaccaacttgacgctgcagtcaccactttaaagagtgatcataccgattatgtagcgatgcagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3361411 |
cctgaaatttgttgtagtgctttgaccaaaagaatcgaccaacttgacgctgcggtcaccactttaaagagtgatcataccgattatgtagcgatgcagg |
3361312 |
T |
 |
| Q |
101 |
tcctattgcatagtaaacctgctgagacacttcatgaaataatgaaggctttacttgaagatcatcggcaagattctcatggcaaggtttggctttaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
3361311 |
tcctattgcatagtaaacctgctgagacacttcatgaaataatgaaggctttacttgaagatcatcggcaagattcacatggcaaggtttggct----tt |
3361216 |
T |
 |
| Q |
201 |
acatgaagttcagtgctttagat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3361215 |
acatgaagttcagtgctttagat |
3361193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University