View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9119_low_65 (Length: 216)
Name: NF9119_low_65
Description: NF9119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9119_low_65 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 26 - 201
Target Start/End: Complemental strand, 43008787 - 43008612
Alignment:
| Q |
26 |
atacatatttcatttgacataaatctctcttagataaattttgaagaatgaaaataagagaatcaaattgcttttgattatctatttaaattgatccatt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43008787 |
atacatatttcatttgacataaatctctcttagataaattttgaagaatgaaaataagagaatcaaattgcttttgattatctatttaaattgatctatt |
43008688 |
T |
 |
| Q |
126 |
gtactaaaccaaaccaatggagcccacatatcttaatagagctctatatatctactcattattctttccctcatct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43008687 |
gtactaaaccaaaccaatggagcccacatatcttaatagagctctatatatctactcattattctttccctcatct |
43008612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University