View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9121_high_2 (Length: 333)

Name: NF9121_high_2
Description: NF9121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9121_high_2
NF9121_high_2
[»] chr2 (1 HSPs)
chr2 (208-316)||(34617782-34617886)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 208 - 316
Target Start/End: Complemental strand, 34617886 - 34617782
Alignment:
208 tcaattaggggaaaatatgtgatgtaagcatactgtgccatgttgctggtggcttgtctaaaagtaaatttgtgttcatattaatgtttgggggcatcaa 307  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||  |||||||  ||||||||||||||||||||||||||||||    
34617886 tcaattaggggaaaatatgtgatgtaagcataatgtgccatgttgctggtggcttgtct--aagtaaa--tgtgttcatattaatgtttgggggcatcaa 34617791  T
308 agagtatct 316  Q
    |||||||||    
34617790 agagtatct 34617782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University