View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9121_low_20 (Length: 240)
Name: NF9121_low_20
Description: NF9121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9121_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 19346728 - 19346951
Alignment:
| Q |
16 |
caatgtttgaaggctagatatggactgaaaagaagttggtaatgcagagaagttcaagccttttaaatccaacacctgtaggctttccataccctcaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19346728 |
caatgtttgaaggctagatatggactgaaaagaagttggtaatgcagacaagttcaagccttttaaatccaacacctgtaggctttccataccctcaaaa |
19346827 |
T |
 |
| Q |
116 |
acaatatttgagatctctacagagggttccacactctcgaagaagaaaaacttagcattaggacaatctaacctttcaggaagcttgcggacattacagc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19346828 |
acaatatttgagatctctacagagggttgcacactctcgaagaagaaaaacttagcattaggacaatctaacctttcaggaagcttgcggacattacagc |
19346927 |
T |
 |
| Q |
216 |
catataagatgatctgtgagcttt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
19346928 |
catataagatgatctgtgagcttt |
19346951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University