View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9121_low_7 (Length: 333)
Name: NF9121_low_7
Description: NF9121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9121_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 208 - 316
Target Start/End: Complemental strand, 34617886 - 34617782
Alignment:
| Q |
208 |
tcaattaggggaaaatatgtgatgtaagcatactgtgccatgttgctggtggcttgtctaaaagtaaatttgtgttcatattaatgtttgggggcatcaa |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34617886 |
tcaattaggggaaaatatgtgatgtaagcataatgtgccatgttgctggtggcttgtct--aagtaaa--tgtgttcatattaatgtttgggggcatcaa |
34617791 |
T |
 |
| Q |
308 |
agagtatct |
316 |
Q |
| |
|
||||||||| |
|
|
| T |
34617790 |
agagtatct |
34617782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University