View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9121_low_8 (Length: 332)
Name: NF9121_low_8
Description: NF9121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9121_low_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 13 - 332
Target Start/End: Original strand, 40595277 - 40595591
Alignment:
| Q |
13 |
agctgtactagtagtcttgttggattttctcagcattctgactctgatcccaactggatattcctatcccattgttgttctagacatgtccttcaattat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40595277 |
agctgtactagtagtcttgttggattttctcagcattctgactctgatcccaactggatattcctatcccattgttgttctagacatgtccttcaattat |
40595376 |
T |
 |
| Q |
113 |
tcattcacctcttctatactttgcaaattgcaagtcttgcaagattttggccgattttatttatgctctctttttaattattagggttagaacattcaca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40595377 |
tcattcacctcttctatactttgcaaattgc---------aagattttggccgattttatttatgctctctttttaattattagggttagaacattcaca |
40595467 |
T |
 |
| Q |
213 |
tgtttatagagattcttttgtgaaaattatgtattaac----ttagaaccaagtaattaatttgtttaaattcacttgattttcttctttttcaatttga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40595468 |
tgtttatagagattcttttgtgaaaattatgtattaacttaattagaaccaagtatttaatttgtttaaattcacttgattttcttctttttcaatttga |
40595567 |
T |
 |
| Q |
309 |
acaactcaccaatatcaaatgctt |
332 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40595568 |
acaactcaccaatatcaaatgctt |
40595591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University