View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9122_high_13 (Length: 318)
Name: NF9122_high_13
Description: NF9122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9122_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 48236943 - 48236762
Alignment:
| Q |
18 |
gtaaaacaataatttttcttgttaccaggcagaacaaattcgtagatggaaagaggaagagggacgaaaggttgtggaagttaggttatctcaggaggca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236943 |
gtaaaacaataatttttcttgttaccaggcagaacaaattcgtagatggaaagaggaagagggacgaaaggttgtggaagttaggttatctcaggaggca |
48236844 |
T |
 |
| Q |
118 |
gctctagcaatagcagaaagggagaaggctaaagccaaagctgcattggaagcagcagaggaagccaagaggaaggctgaac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236843 |
gctctagcaatagcagaaagggagaaggctaaagccaaagctgcattggaagcagcagaggaagccaagaggaaggctgaac |
48236762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 261 - 318
Target Start/End: Complemental strand, 48236700 - 48236643
Alignment:
| Q |
261 |
taaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacactatgatg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236700 |
taaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacactatgatg |
48236643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University