View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9122_high_26 (Length: 218)

Name: NF9122_high_26
Description: NF9122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9122_high_26
NF9122_high_26
[»] chr2 (1 HSPs)
chr2 (1-188)||(40010786-40010973)


Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 40010786 - 40010973
Alignment:
1 agaaggattggatactttgaaaaatctagcccttgatatgaatgaggttacgaatcttgtctttctagtaattccacttggaaatgtttgattttaagag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40010786 agaaggattggatactttgaaaaatctagcccttgatatgaatgaggttacgaatcttgtctttctagtaattccacttggaaatgtttgattttaagag 40010885  T
101 gataatcattttctctttcttttcgcatcaactatgttcaggaaatagaacgtcaagttcctttaatggatgaaatggacgcaaaggt 188  Q
    |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40010886 gataatcattttctctttcttttcgcctcgactatgttcaggaaatagaacgtcaagttcctttaatggatgaaatggacgcaaaggt 40010973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University