View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9122_low_42 (Length: 288)
Name: NF9122_low_42
Description: NF9122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9122_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 214 - 271
Target Start/End: Complemental strand, 31593713 - 31593656
Alignment:
| Q |
214 |
taaaattgcttttaactcaactacacaatcaaccacaatttttaacatacatgaattg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31593713 |
taaaattgcttttaactcaactacacaatcaaccacaatttttaacatacatgaattg |
31593656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 31593760 - 31593712
Alignment:
| Q |
16 |
ggtgttgactttggttttattggtagcactcggttagatggtgtttgta |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31593760 |
ggtgttgactttggttttattggtagcactcggttacatagtgtttgta |
31593712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 17 - 181
Target Start/End: Complemental strand, 3015787 - 3015624
Alignment:
| Q |
17 |
gtgttgactttggttttattggtagcactcggttagatggtgtttgtattgataattttatgggttttcttttgagtgttccatctatatacaacgtctt |
116 |
Q |
| |
|
||||||| ||||||||| || ||||||||| ||||| ||||||| |||| | ||||||| ||||| |||| ||||||||| |||||| |||||| |
|
|
| T |
3015787 |
gtgttgattttggttttggtg-tagcactcgattagaaggtgtttatattagtgtttttatgagtttttttttttgtgttccatttatataagtcgtctt |
3015689 |
T |
 |
| Q |
117 |
tactttataatttttattgttgatccctgatcattttgtgcagggacttgattaataaattttgc |
181 |
Q |
| |
|
|| ||| |||||||| |||||| ||| || | | ||||||||| | ||| |||||||||||||| |
|
|
| T |
3015688 |
taatttgtaatttttgttgttggtccttgtttgtcttgtgcaggaatttggttaataaattttgc |
3015624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 108
Target Start/End: Complemental strand, 930713 - 930622
Alignment:
| Q |
16 |
ggtgttgactttggttttattggtagcactcggttagatggtgtttgtattgataattttatgggttttcttttgagtgttccatctatatac |
108 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||| | | ||||| | ||||||| |||||||||| ||||||| |||||||| |
|
|
| T |
930713 |
ggtgttgactttggttttggtggtagcactgagttagatggtatctatattg-tgattttataaattttcttttgggtgttccgcctatatac |
930622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University