View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9122_low_45 (Length: 275)
Name: NF9122_low_45
Description: NF9122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9122_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 97 - 260
Target Start/End: Complemental strand, 35909856 - 35909695
Alignment:
| Q |
97 |
tttagaactagctttgctaatggttgacaagtatcacaaacaagcttgttcattaacaacattctcccatatgactgacttagaaatagtaaagtgttat |
196 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35909856 |
tttagaactagctttgctaatgtttgacaagtatcacaaacaagcttgttcattaacaacattctcccatatgactgacttagaaatagtaaagtgttat |
35909757 |
T |
 |
| Q |
197 |
cagtgtaaacactgaacttgagattgtgtggcatccactagaatcttgtacaatccaaccattt |
260 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
35909756 |
cagtgtaaacactgaacttgagat--tgtggcatccactagaatcttgtacattccaaacattt |
35909695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 90
Target Start/End: Original strand, 32494501 - 32494561
Alignment:
| Q |
30 |
tggttgatttctcgagaaatgttgcgaatccacctccagtctccttgttgtagacttgctc |
90 |
Q |
| |
|
||||||||||||| | || || || |||||||||| | |||||||||||||||||||||| |
|
|
| T |
32494501 |
tggttgatttctcaacaactgctgtgaatccacctttaatctccttgttgtagacttgctc |
32494561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University