View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9122_low_54 (Length: 225)
Name: NF9122_low_54
Description: NF9122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9122_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 47846591 - 47846800
Alignment:
| Q |
1 |
tctttatatcattatcggttcttcccggcaattgacccgcaatcaccgaccatctgcgcgcggcatcaaacaaattaaaccgaaattaataagcataatt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47846591 |
tctttatatcattatcggttcttccgggcaattgacccgcaatcaccgaccatctgcgcgcggcatcaaacaaattaaaccgaaattaataagcataatt |
47846690 |
T |
 |
| Q |
101 |
gttttgctttatacaccgatatttcagattaaatacatgttgttgtcactaaaattgatatatacatagtacacttacctgcttccaatagtaacataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47846691 |
gttttgctttatacaccgatatttcagattaaatacatgttgttgtcactaaaattgatatatacatagtacacttacctgcttccaatagtaacataaa |
47846790 |
T |
 |
| Q |
201 |
ggctgcaaat |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
47846791 |
ggctgcaaat |
47846800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University