View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9123_low_13 (Length: 239)
Name: NF9123_low_13
Description: NF9123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9123_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 44379376 - 44379154
Alignment:
| Q |
1 |
ctttgaagctgcataatttgcatagtgaaaataatgtactgtctcatgtgtgcatgtaacatttattgttcttatcaaatgcaggtgaatgctgtgacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44379376 |
ctttgaagctgcataatttgcatagtgaaaataatgtactgtctcatgtgtgcatgtaacatttattgttcttatcaaatgcaggtgaatgctgtgacag |
44379277 |
T |
 |
| Q |
101 |
aattgagtggacaaatttgccagatctgtagggatgagatagagtttacagtggatgatgaaccttttgttgcttgcaatgaatgtgcattccctgtgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44379276 |
aattgagtggacaaatttgccagatctgtggggatgagatagagtttacagtggatgatgaaccttttgttgcttgcaatgaatgtgcattccctgtgtg |
44379177 |
T |
 |
| Q |
201 |
tagaccttgctatgactatgaaa |
223 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
44379176 |
tagaccttgctatgagtatgaaa |
44379154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 166 - 223
Target Start/End: Complemental strand, 1180100 - 1180043
Alignment:
| Q |
166 |
tttgttgcttgcaatgaatgtgcattccctgtgtgtagaccttgctatgactatgaaa |
223 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| |||||| ||| ||||| ||||||| |
|
|
| T |
1180100 |
tttgtggcttgcaatgaatgtgcatttcctgtttgtagaaattgttatgaatatgaaa |
1180043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University