View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9123_low_14 (Length: 221)
Name: NF9123_low_14
Description: NF9123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9123_low_14 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 116 - 221
Target Start/End: Original strand, 15112857 - 15112962
Alignment:
| Q |
116 |
atatgagaatagtgtagttacttcgttcatctaataataactattagtaataagataaacaatagcatttcagtacgattacaacgactcaagctaaggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||| |||||||| |||||||||||| | |
|
|
| T |
15112857 |
atatgagaatagtgtagttacttcgttcatctaataataaatagtagtaataagataaacgatagcatttcagtatgattacaatgactcaagctaactt |
15112956 |
T |
 |
| Q |
216 |
ttacta |
221 |
Q |
| |
|
|||||| |
|
|
| T |
15112957 |
ttacta |
15112962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University