View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9124_high_3 (Length: 329)
Name: NF9124_high_3
Description: NF9124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9124_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 143 - 307
Target Start/End: Complemental strand, 15403790 - 15403632
Alignment:
| Q |
143 |
ggacaaatggagcatagtcaattgcagacgatctaatggattttggatagactctgatatctcaatagataccggataagcaaatgtgaccacacaattt |
242 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
15403790 |
ggacaaatggagcatagccaattgcagacgatctaatagattttggatagactctgatatctcaatagataccggataagaaaatgtaaccacacaattt |
15403691 |
T |
 |
| Q |
243 |
atttcacaactttagtgcttcaataatctcacacatccaaagaactttatataaccacatgacta |
307 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
15403690 |
atttcac------agtgcttcaataatctcacacatccaaagaactgtatatcaccacatgacta |
15403632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 27 - 90
Target Start/End: Complemental strand, 15403852 - 15403789
Alignment:
| Q |
27 |
ttggtgtttactcatacaacttgatttgagccctactcaaggcatacaaaattgatttctaagg |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15403852 |
ttggtgtttactcatacaacttgatttgagccctactcaaggcatacaaaattgatttctaagg |
15403789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University