View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9124_high_4 (Length: 277)
Name: NF9124_high_4
Description: NF9124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9124_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 45410400 - 45410661
Alignment:
| Q |
1 |
ataaaatgaaaggggagttttctgttgatttgaagcttggtcaggttgggaactctgccactgatcaatcaccacttcctttgtctaatgatgctgttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45410400 |
ataaaatgaaaggggagttttctgttgatttgaagcttggtcaggttgggaactctgccactgatcaatcaccacttcctttgtctaatgatgctgttgt |
45410499 |
T |
 |
| Q |
101 |
tgtctccaaaattgcaacacctacttcttcatcaggatcttctaagagagctagagctatgaataataatacaacattgacagtttcttgtcttgtggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45410500 |
tgtctccaaaattgcaacacctacttcttcatcaggatcttctaagagagctagagctatgaataataatacaacattgacagtttcttgtcttgtggat |
45410599 |
T |
 |
| Q |
201 |
gggtgcaattctgatcttagtaattgtagagattatcataggcgtcataaggtttgtgaact |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45410600 |
gggtgcaattctgatcttagtaattgtagagattatcataggcgtcataaggtttgtgaact |
45410661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 182 - 262
Target Start/End: Original strand, 40623631 - 40623711
Alignment:
| Q |
182 |
agtttcttgtcttgtggatgggtgcaattctgatcttagtaattgtagagattatcataggcgtcataaggtttgtgaact |
262 |
Q |
| |
|
|||||| |||||||||||||| || | ||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
40623631 |
agtttcatgtcttgtggatggttgtcaagctgatcttagtaactgtagagactatcataggcgtcataaggtctgtgaact |
40623711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University