View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9126_low_9 (Length: 371)
Name: NF9126_low_9
Description: NF9126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9126_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 358
Target Start/End: Complemental strand, 30778744 - 30778387
Alignment:
| Q |
1 |
ggtgtgatctttgactgcatggtgcaagtttgtgggttaggttttggcgtctttttgatttacgtttgataaagatgttaccttagtggagattaggagg |
100 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30778744 |
ggtgtgatctttgactgcatggtgaaggtttgtgggttaggttttggcgtccttttgatttacgtttgataaaggtgttaccttagtggagattaggagg |
30778645 |
T |
|
| Q |
101 |
ctagcatgggggattgataggctagggtaaccgtggaagaagacgtctccatgtgatttagttgtcggttgtttaaga-gtttggaaggacaagaatagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
30778644 |
ctagcatgggggattgataggctaggatagcggtggaagaagacgtctccatgtgatttagttgtcggttgtttaagatatttggaaggataagaatagt |
30778545 |
T |
|
| Q |
200 |
cgtatttttcgacatatagatcaatcgatacagcaaccggtgaacatcgtgaagttttcttcttttagatggttacaatcgaaaattaacaacttagcct |
299 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
30778544 |
cgtatttttcgacatataga-caatcgatacaacaaccggtgaatatcgtgaaattttcttcttttagatggttacaaccgaaaattaacaacttagctt |
30778446 |
T |
|
| Q |
300 |
ttgattttcatcatcggtggacaagcaaaaattgcaacttagcttttgattttcatcat |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30778445 |
ttgattttcatcatcggtggacaagcaaaaattgcaacgtagcttttgattttcatcat |
30778387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University