View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9127_low_8 (Length: 400)
Name: NF9127_low_8
Description: NF9127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9127_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 4e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 154 - 384
Target Start/End: Complemental strand, 28710768 - 28710538
Alignment:
| Q |
154 |
cagaggaggtacaatacttccaattattttgagttcggtatccttttctagatatttcaagtttttcattatagttatctattttctggttcttgtttga |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
28710768 |
cagaggaggtacaatacttccaattattttgagttcggtatccttttctagatattgcaagtttttcattatagttatccattttctggttcttctttga |
28710669 |
T |
 |
| Q |
254 |
ttttcaacagggccattgtgcattatagttgtaaaattannnnnnnnnnnnngctagtttggagggaaaagggctgggagggtttagnnnnnnngaatga |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28710668 |
ttttcaacagggccattgtgcattatagttgtaaaattatttttgtttttttgctagtttggagggaaaagggctgggagggtttagaaaaaaacaatga |
28710569 |
T |
 |
| Q |
354 |
gcaaattgaagaaaataaagagctttaggag |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28710568 |
gcaaattgaagaaaataaagagctttaggag |
28710538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 16 - 74
Target Start/End: Complemental strand, 28710908 - 28710850
Alignment:
| Q |
16 |
acatcagctattacacatgtgtatgagttggattcttggaaggttgtgagtgtgaacgg |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28710908 |
acatcagctattacacatgtgtatgagttggattcttggaaggttgtgagtgtgaacgg |
28710850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University