View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9128_low_9 (Length: 212)
Name: NF9128_low_9
Description: NF9128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9128_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 76 - 195
Target Start/End: Original strand, 27863119 - 27863238
Alignment:
| Q |
76 |
tggacggtggagatgcggcgaaggtggaggttaataaaatggagtatcagtatccgatacaagctccgatgtattattatgaaggtcaaagtagtaatta |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27863119 |
tggacggtggagatgcggcgaaggtggaggttaataaaatggagtatcagtatccgatacaagctccgatgtattattatgaaggtcaaagtagtaatta |
27863218 |
T |
|
| Q |
176 |
tgctggtatggatcaatttc |
195 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27863219 |
tgctggtatggatcaatttc |
27863238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University