View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9129_low_14 (Length: 254)
Name: NF9129_low_14
Description: NF9129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9129_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 184 - 239
Target Start/End: Original strand, 32327543 - 32327598
Alignment:
| Q |
184 |
atcttttaaatgatttttatttttaagtttgttgaggacgaagcagactagttagt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32327543 |
atcttttaaatgatttttatttttaagtttgttgaggacgaagcagactagttagt |
32327598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 32327242 - 32327292
Alignment:
| Q |
5 |
ggttaaattgttctttgaaattgtattgtaatacacttgttctgcatcttc |
55 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32327242 |
ggttaaattgttctttgaaattgtatcgtaatacacttgttctgcatcttc |
32327292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 175
Target Start/End: Original strand, 32327289 - 32327345
Alignment:
| Q |
119 |
cttcatatatgactacannnnnnnnccatcttcctcttcatcaatttgcattctttt |
175 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32327289 |
cttcatatatgactacattttttttccatcttcctcttcatcaatttgcattctttt |
32327345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University