View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9129_low_16 (Length: 252)
Name: NF9129_low_16
Description: NF9129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9129_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 32326977 - 32327221
Alignment:
| Q |
1 |
tgtttcgttcaatgtacgtggaaccttaaagtcaatttcaaacagataagtctgaaccgtttt-ttaatgtaacatgctaaaatattaagtgtaggacat |
99 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32326977 |
tgtttcgttgaatgtacgtggaaccctaaagtcaatttcaaacagataagtctgaaccgtttttttaatgtaacatgctaaaatattaagtgtaggacat |
32327076 |
T |
 |
| Q |
100 |
cttttagttacattttctctcaattatgagtcc-nnnnnnnnnnggtctagttatgagtcctttctttagtgaggcttaaaacaagtattttagttattg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32327077 |
cttttagttacattttctctcaattatgagtcctttttttttttggtctagttatgagtcctttctttagtgaggcttaaaacaagtattttagttattg |
32327176 |
T |
 |
| Q |
199 |
ttcaagagtcatttaagtttggacccatagaggaatgacggataa |
243 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
32327177 |
ttcaagagtcatttaagcttgaacccatagaggaatgacggataa |
32327221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University