View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9130_low_20 (Length: 354)
Name: NF9130_low_20
Description: NF9130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9130_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 10 - 335
Target Start/End: Complemental strand, 46503510 - 46503185
Alignment:
| Q |
10 |
gcagagaggaagctcacgtttgaaagcatcgattttgagacgttcttcttctaagcgagaaacaaattcttcgagtttgtagctttgatcactttgttct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503510 |
gcagagaggaagctcacgtttgaaagcatcgattttgagacgttcttcttctaagcgagaaacaaattcttcgagtttgtagctttgatcactttgttct |
46503411 |
T |
 |
| Q |
110 |
ccaaatgatttcagtaacatggagtagctatgtggcttgcaatccaagcctagttcagatgatgaagccattctttgttaaaaaactaaataataatcac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||| |
|
|
| T |
46503410 |
ccaaatgatttcagtaacatggagtagctatgtggcttgcaatccaagcctagttcagatgatgaagccattctttgttaaaaaaataaattataagcac |
46503311 |
T |
 |
| Q |
210 |
tgttttttaagatatagatatgttcatatgacaaaatagaaaagaaggtggtttgtatgtaggaagaaacaagagcaaaagagagtgtttggcttattgc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503310 |
tgttttttaagatatagatatgttcatatgacaaaatagaaaagaaggtggtttgtatgtaggaagaaacaagagcaaaagagagtgtttggcttattgc |
46503211 |
T |
 |
| Q |
310 |
tttgtagttcttgtgggggagaggga |
335 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46503210 |
tttgtagttcttgtgggggagaggga |
46503185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University