View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9130_low_29 (Length: 251)
Name: NF9130_low_29
Description: NF9130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9130_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 46918971 - 46918742
Alignment:
| Q |
16 |
atactagtattcaatattctttgcttgctgaacctgttgctgcaactgcaatgagagaaattgagacttccaaaggta-aaaaccaaaattttgctgtct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
46918971 |
atactagtattcaatattctttgcttgctgaacctgttgctgcaactgcaatgagagaaattgagacttccaaaggtaaaaaaccaaaattttgctttct |
46918872 |
T |
|
| Q |
115 |
ccaatgttcttctagtttcttgtaggatacgcaattgttaggacaattgtttaaatgttttgctctaatatttatttttatattgggaatctctaccgta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
46918871 |
ccaatgttcttctagtttcttgtaggatacgcaattgttaggacaattgtttaaatg-tttgctctaatatacattttcatattgggaatctctaccgta |
46918773 |
T |
|
| Q |
215 |
cacttcacaaaagaagtgtaccggtactctt |
245 |
Q |
| |
|
||| |||||||||| ||||||||||||||| |
|
|
| T |
46918772 |
cacctcacaaaagagatgtaccggtactctt |
46918742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 144
Target Start/End: Complemental strand, 30244581 - 30244549
Alignment:
| Q |
112 |
tctccaatgttcttctagtttcttgtaggatac |
144 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
30244581 |
tctccaatgttcttctagtttcttggaggatac |
30244549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University