View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9131_low_5 (Length: 373)
Name: NF9131_low_5
Description: NF9131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9131_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 17 - 362
Target Start/End: Complemental strand, 8022681 - 8022336
Alignment:
| Q |
17 |
caaatatatatgggaaattgttgcacatcgtcttcgatggagtgggccggagaagattggggatcactgacatcaaaccataagagtaggatgaattcaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022681 |
caaatatatatgggaaattgttgcacatcatcttcgatggagtgggccggagaagattggggatcactgacatcaaaccataagagtaggatgaattcaa |
8022582 |
T |
 |
| Q |
117 |
gcaaagtttttgatgaagttcatggtttgagtttggggaacatagagaaagagaagcttttaggtgcactaagagcttcttctgatgctaatggtaaggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022581 |
gcaaagtttttgatgaagttcatggtttgagtttggggaacatagagaaagagaagcttttaggtgcactaagagcttcttctgatgctaatggtaaggt |
8022482 |
T |
 |
| Q |
217 |
gaaaataaagatatcaaagaaagaacttgcggtattgttgggagaatcagagaaacagggtgttggaagcacaaaacatgcttctgctgaacatgttttg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022481 |
gaaaataaagatatcaaagaaagaacttgcggtattgttgggagaatcagagaaacagggtgttggaagcacaaaacatgcttctgctgaacatgttttg |
8022382 |
T |
 |
| Q |
317 |
gttggtttgttaaatgctagagatcatgtcaaccatgatgtccatc |
362 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022381 |
gttggtttgctaaatgctagagatcatgtcaaccatgatgtccatc |
8022336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University