View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9131_low_9 (Length: 255)
Name: NF9131_low_9
Description: NF9131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9131_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 255
Target Start/End: Complemental strand, 798661 - 798421
Alignment:
| Q |
15 |
agagaggacatgtattacgagtttgtttatagatttatgactggatctagatttatggctgaattagagagaacctgtacgaggaaagtcataaattatt |
114 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
798661 |
agagagaacatgtattacgagtctgtttatagatttatgattggatctggatttatggctgaattagagagaacctgtacgaggaaaatcataaatcatt |
798562 |
T |
 |
| Q |
115 |
ttttatcaaaatgatggcgttgatggggaatgcgtcaaattagattgattttcgcttgttaaacaaagtttatgttctgttatgtaaaattttctaagca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
798561 |
ttttatcaaaatgatggcgttgatggggaatgcgtcaaattagattgattttcgcttgttaaacaaagcttatgttctgttctgtaaaattttctaagca |
798462 |
T |
 |
| Q |
215 |
agccttcttttcccaacgaaccagagagaacatgtatatat |
255 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
798461 |
agccttcttttcccaaggaaccagagagaacatgtatatat |
798421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University