View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9132_high_3 (Length: 488)
Name: NF9132_high_3
Description: NF9132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9132_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 445; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 445; E-Value: 0
Query Start/End: Original strand, 13 - 473
Target Start/End: Complemental strand, 41094416 - 41093956
Alignment:
| Q |
13 |
atcaggaagaacaggaccttcagaagagaagattccatcatcagtttcattggtttgaaacggagtaacgaaatcagggttagggttaaggcttgaaact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41094416 |
atcaggaagaacaggaccttcagaagagaagattccatcatcagtttcattggtttgaaacggagtaacgaaatcagggttagggttagggcttgaaact |
41094317 |
T |
|
| Q |
113 |
ccgaatccatatccgggaggagaatgttggtcattgttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094316 |
ccgaatccatatccgggaggagaatgttggtcattgttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatg |
41094217 |
T |
|
| Q |
213 |
tggatccataatcaaactgctgttgagaattgaatccttcatagttactattattgtcatcttcaaaaggtcctcctactactactcctcctcctccacc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094216 |
tggatccataatcaaactgctgttgagaattgaatccttcatagttactattgttgtcatcttcaaaaggtcctcctactactactcctcctcctccacc |
41094117 |
T |
|
| Q |
313 |
agtggttggagattgatgatgtgactgctcttcctcaaacgagtctagagactccatagttgaattaccttagcttcggatcacaattctttccgttcct |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41094116 |
agtggttggagattgatgatgtgactgctcttcctcaaacgagtctagagactccatagttgaattaccttagcttcggatcacaattctttctgttcct |
41094017 |
T |
|
| Q |
413 |
ttgttttgcctttcacaaatcacaacaaccataagtaacttcaattgcaacgtgtcatatg |
473 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41094016 |
ttgttttgcctttcacaaatcacaacaaccataactaacttcaattgcaacgtgtcatatg |
41093956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University