View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9133_high_14 (Length: 391)
Name: NF9133_high_14
Description: NF9133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9133_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 124 - 380
Target Start/End: Complemental strand, 3177455 - 3177199
Alignment:
| Q |
124 |
tttgcaagtgaagcaaaatacatacctgtcatgtctaaaattatgcatttcaatgcacttccgttgagtgctaccacgcgttcttcctcttctcgaaccc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3177455 |
tttgcaagtgaagcaaaatacatacctgtcatgtctaaaattatgcacttcaatgcacttccgttgagtgctaccacgcgttcttcctcttctcgaaccc |
3177356 |
T |
|
| Q |
224 |
atctcagtatcctaaagaaagagaaacactcnnnnnnntgccttgaactaatctttgaaatgtacaaaacttgacaagaatacatattgccttataaatg |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3177355 |
atctcagtatcctaaagaaagagaaacactcaaaaaaatgccttgaactaatctttgaaatgtacaaaacttgacaagaatacatattgccttataaatg |
3177256 |
T |
|
| Q |
324 |
tggaccagatacatatacttttttgtttatacttaagtcgagagggagtattatcta |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3177255 |
tggaccagatacatatacttttttgtttatacttaagtcgagagggagtattatcta |
3177199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 3177559 - 3177520
Alignment:
| Q |
20 |
aatgtatcgataccacttgtgtctatgccagtcacggctg |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3177559 |
aatgtatcgataccacttgtgtctatgccagtcacggctg |
3177520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University