View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9133_high_30 (Length: 270)
Name: NF9133_high_30
Description: NF9133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9133_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 17 - 254
Target Start/End: Complemental strand, 7542558 - 7542321
Alignment:
| Q |
17 |
ggaagacaatttatcctcagtttgagccttcatccatgttaacatattttgccatcttaatgtcacattacttcccatgtttgaaaacatttcttcaggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542558 |
ggaagacaatttatcctcagtttgagccttcatccatgttaacatattttgccatcttaatgtcacattacttcccatgtttgaaaacatttcttcaggt |
7542459 |
T |
 |
| Q |
117 |
ataggtatttcaagaacagtttccaatccatcttctttgtctatgtttggacataacctccttaatgatgattttgcagcaggttgtttcatttgattag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542458 |
ataggtatttcaagaacagtttccaatccatcttctttgtctatgtttggacataacctccttaatgatgattttgcagcaggttgtttcatttgattag |
7542359 |
T |
 |
| Q |
217 |
tgtgagattgagacaagtgaagaatttgatgagagaaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542358 |
tgtgagattgagacaagtgaagaatttgatgagagaaa |
7542321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University