View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9133_high_32 (Length: 268)
Name: NF9133_high_32
Description: NF9133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9133_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 229
Target Start/End: Original strand, 43589718 - 43589930
Alignment:
| Q |
19 |
ttaaatgcattaaag--attaaaatttaaagtcacttttttcttattcgattggtcaaataggtaagattgatttggcccgcttgttacacgagacttca |
116 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
43589718 |
ttaaatgcactaaagttattaaaatttaaagtcacttttttcttattcgattggtcaaataggtaagattgatctggcctgcttgttacacgagacttca |
43589817 |
T |
 |
| Q |
117 |
aacatttagcagagctcaaacattaagggctatatgtgccaatggactaaaagagtaaagcgaataatagacttataatactactctttttgtccctaat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
43589818 |
aacatttagcagagctcaaacattaagggctatatgtgccaatggactaaaagagtaaagcgaataatagacttataatactattttttttgtccctaat |
43589917 |
T |
 |
| Q |
217 |
tataagcactctt |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43589918 |
tataagcactctt |
43589930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University