View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9133_high_39 (Length: 239)
Name: NF9133_high_39
Description: NF9133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9133_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 45794897 - 45795017
Alignment:
| Q |
1 |
tttctgaggattaaaatggaaacgaaggattcaactgaactgaaataacaatgacttttgtcacaacagtgctggaaaaattagttccatctcaaagatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794897 |
tttctgaggattaaaatggaaacgaaggattcaactgaactgaaataacaatgacttttgtcacaacagtgctggaaaaattagttccatctcaaagatt |
45794996 |
T |
 |
| Q |
101 |
tcattttttcgtagtaaacat |
121 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
45794997 |
tcattttttcgtagcaaacat |
45795017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 123 - 205
Target Start/End: Original strand, 45795125 - 45795207
Alignment:
| Q |
123 |
agagggtgtgagtgttttccaaagagatctcaaagaagtctatatgtaatccctttatttaatcattctttaaaattgtcaca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45795125 |
agagggtgtgagtgttttccaaagagatctcaaagaagtctatatgtaatccctttatttaatcattctttaaaattgtcaca |
45795207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University