View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9133_high_44 (Length: 202)
Name: NF9133_high_44
Description: NF9133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9133_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 13 - 183
Target Start/End: Original strand, 45345159 - 45345329
Alignment:
| Q |
13 |
gattatactggagatattgatgatagaaggaccacatccggttatgtatttttactgtctggtggagcagtctcatgggcatcaaagaagcagcctgttg |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345159 |
gattatgctggagatattgatgatagaaggaccacatccgattatgtatttttactgtctggtggagcagtctcatgggcatcaaagaagcagcctgttg |
45345258 |
T |
 |
| Q |
113 |
taacattgtccaccactgaggcagagtttgtggcagcctcctcttgtgcttgccaatgtgtgtggatgaga |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45345259 |
taacattgtccaccactgaggcagagtttgtggcagcctcctcttgtgctagccaatgtgtgtggatgaga |
45345329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 79 - 131
Target Start/End: Complemental strand, 654825 - 654773
Alignment:
| Q |
79 |
gcagtctcatgggcatcaaagaagcagcctgttgtaacattgtccaccactga |
131 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||| || ||||| || |||||||| |
|
|
| T |
654825 |
gcagtctcttgggcatcaaagaagcagcttgtagttacattatctaccactga |
654773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University