View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9133_low_106 (Length: 209)
Name: NF9133_low_106
Description: NF9133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9133_low_106 |
 |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 11 - 192
Target Start/End: Complemental strand, 2834462 - 2834281
Alignment:
| Q |
11 |
agcagagaaaagtgtgaatccagccaaatttcgcagtctagtattgatctttgactcatagtatgtgagtattactattgttccaattgcaactggttga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2834462 |
agcaaagaaaagtgtgaatccagccaaatttcgcagtctagtattgatctttgactcatagtatgtgagtattactattgttccaattgcaactggttga |
2834363 |
T |
 |
| Q |
111 |
taaaccaatgtaagtacccttgaaggatgatatttcttcagagtgaaacaaagcatataatcaataattcatctcatatttc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2834362 |
taaaccaatgtaagtacccttgaaggatgatatttcttcagagtgaaacaaagcatataatcaataattcatctcatatttc |
2834281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 147
Target Start/End: Original strand, 64321 - 64417
Alignment:
| Q |
51 |
gtattgatctttgactcatagtatgtgagtattactattgttccaattgcaactggttgataaaccaatgtaagtacccttgaaggatgatatttct |
147 |
Q |
| |
|
|||||||| |||| ||||||||| || || ||| ||| |||||||| ||||| ||| ||||| || | ||||| ||||| || ||||||||||||| |
|
|
| T |
64321 |
gtattgatttttgcctcatagtaagtaagaattgctagtgttccaactgcaaatggctgatatacaagagtaagcaccctagagggatgatatttct |
64417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University