View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9133_low_58 (Length: 298)
Name: NF9133_low_58
Description: NF9133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9133_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 34863403 - 34863128
Alignment:
| Q |
1 |
agttgtcaaggggatttctgatggtttgtcgcgcgggaagaaaccggatgaaatggaaaaattggtaaaattctggttttttgctaatatgaatagatca |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34863403 |
agttctcaaggggatttctgatggtttgtcgcgagggaagaaaccggatgaaatggaaaaattggtaaaattctggttttttgctaatatgaatagatca |
34863304 |
T |
 |
| Q |
101 |
ttagtttactagatattcattttctcttgtgaactattctcatgtaaaaacctcatttgccacaggtaaaggacctatggaaaatgaacatgagacatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34863303 |
ttagtttactagatattcattttctcttgtgaactattctcatgtaaaaacctcatttgccacaggtaaaggacctatggaaaatgaacatgagacatca |
34863204 |
T |
 |
| Q |
201 |
acatgcttctgaagttctgaacaaggatattatatctcattttgttttacgtctcgtgtattgtagaacgtaagag |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34863203 |
acatgcttctgaagttctgaacaaggatattatatctcattttgttttacgtctcgtgtattgtagaacgtaagag |
34863128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 214 - 274
Target Start/End: Original strand, 28735015 - 28735076
Alignment:
| Q |
214 |
gttctgaacaaggatattatatctcatttt-gttttacgtctcgtgtattgtagaacgtaag |
274 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
28735015 |
gttctgaacaaggatattatatcgcatttttgttttacgtttggtgtattgtagaacgtaag |
28735076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 180 - 252
Target Start/End: Original strand, 28735119 - 28735192
Alignment:
| Q |
180 |
gaaaatgaacatgagacatcaacatgcttctgaagttctgaacaaggatattatatctcatttt-gttttacgt |
252 |
Q |
| |
|
|||| ||||||| ||||| || |||||| |||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
28735119 |
gaaagtgaacataagacaacagcatgctactgaagttctgaacaaggatattatatcgcattttggttttacgt |
28735192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University