View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9133_low_67 (Length: 274)
Name: NF9133_low_67
Description: NF9133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9133_low_67 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 48800719 - 48800992
Alignment:
| Q |
1 |
caggatcgatgttcactgccacggatggttgtgcatttattggacactgttttattagctgatcagcataattagtatcaatggtttggtcaatgagcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48800719 |
caggatcgatgttcactgccacggatggttgtgcatttattggacactgttttattagctgatcagcataattagtatcaatggtttggtcaatgagcct |
48800818 |
T |
|
| Q |
101 |
aagacttccatttctgtcttgttggaaacgacccctgaatgtattgcaatgagctgttcctattgtatgagcccctgcaaagcttaacaattagtactaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48800819 |
aagacttccatttctgtcttgttggaaacgacccctgaatgtattgcaatgagctgttcctattgtatgagcccctgcaaagcttaacaattagtactaa |
48800918 |
T |
|
| Q |
201 |
atatgtaacactagttagatattaaagtaaatatagtgagaagaagcagacaatcaaataaagcatgagatatt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48800919 |
atatgtaacactagttagatattaaagtaaatatagtgagaagaagcagacaatcaaataaagcatgagatatt |
48800992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University