View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9133_low_68 (Length: 273)
Name: NF9133_low_68
Description: NF9133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9133_low_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 27666291 - 27666491
Alignment:
| Q |
1 |
agtaagccataacttggagtgaatagagctgttgtaactcgattctttttaagggtgttctaactagatttgtaggtctacattaagctcttttcatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27666291 |
agtaagccataacttggagtgaatagagctgttgtaactcgattctttttaagggtgttctaactagatttgtaggtctacattaagctcttttcatatt |
27666390 |
T |
 |
| Q |
101 |
gtactcaactactgtatctgaaatgaaatcattttaatgaattcatgctacgctaggatagaaatgattaaaattcgaattctttagcattgtttcttat |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27666391 |
gta-------actgtatctgaaatgaaatcattttaatgaattcatgctacgctaggatagaaatgattaaaattcgaattctttagcattgtttcttat |
27666483 |
T |
 |
| Q |
201 |
atataaga |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
27666484 |
atataaga |
27666491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University