View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9133_low_84 (Length: 250)
Name: NF9133_low_84
Description: NF9133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9133_low_84 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 9 - 250
Target Start/End: Original strand, 37650193 - 37650434
Alignment:
| Q |
9 |
tcgtgttcccttgaaagaacgattagatagagttttgagcaatacagtttggcaaactcttttccctaaacccaatattatccatcttccaatcaattcc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37650193 |
tcgtgttcccttgaaagaacgattagatagagttttgagcaatacagtttggcaaactcttttccctaaacccaatattatccatcttccaatcaattcc |
37650292 |
T |
 |
| Q |
109 |
tttgaccattcgggactttggttacagctagggagtaaaagtaatatttctagaagaaattatttcaaatttctttgttcttggttggagcatccagagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37650293 |
tttgaccattcgggactttggttacaactagggagtaaaagtaatatttctagaagaaattatttcaaatttctttgttcttggttggagcatccagagt |
37650392 |
T |
 |
| Q |
209 |
ttaaaaactaaatgattcattcttggagcaactcagacaact |
250 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37650393 |
tttaaaactaaatgattcattcttggagcaactcagacaact |
37650434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University