View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9133_low_89 (Length: 249)
Name: NF9133_low_89
Description: NF9133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9133_low_89 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 4 - 249
Target Start/End: Original strand, 45794651 - 45794895
Alignment:
| Q |
4 |
gagtttggtgttcatcttaactaatgagtgcagagttttggtgctaaatttgtacacatgtcaataccaatctgtaaggcaccactaaaacttagtttat |
103 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794651 |
gagtttggttttcatct-aactaatgagtgcagagttttggtgctaaatttgtacacatgtcaataccaatctgtaaggcaccactaaaacttagtttat |
45794749 |
T |
 |
| Q |
104 |
gtactcactcatatacaaaggtcaaaaagattaatcctagagaccatagaggagaaagttttgttcttatctaactaaaaactcagctatctcatttcta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794750 |
gtactcactcatatacaaaggtcaaaaagattaatcctagagaccatagaggggaaagttttgttcttatctaactaaaaactcagctatctcatttcta |
45794849 |
T |
 |
| Q |
204 |
aagcatcccttattagttattagaaactttaatctgggcaacccct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794850 |
aagcatcccttattagttattagaaactttaatctgggcaacccct |
45794895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University