View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9134_high_4 (Length: 322)
Name: NF9134_high_4
Description: NF9134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9134_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 18 - 318
Target Start/End: Complemental strand, 49277891 - 49277586
Alignment:
| Q |
18 |
gatgttatccgtaaccctgaagccattggctcgccagtttatttctatgaatatgaac-----tacattccaactctcactgatctcaccgttgagattc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49277891 |
gatgttatccgtaaccctgaagccattggctcgccagtttatttctatgaatatgaacatgattacattccaactctcactgatctcaccgttgagattc |
49277792 |
T |
|
| Q |
113 |
caatattgggtagtccttgcagtgagagaaaagtgtggaagatttcaaaagagggaactagagctaggttttggtttgtgagcaccggtggttttcctgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49277791 |
caatattgggtagtccttgcagtgagagaaaagtgtggaagatttcaaaagagggaactagagctaggttttggtttgtgagcaccggtggttttcctgg |
49277692 |
T |
|
| Q |
213 |
gaacctttttagccagttcaagattgagaggcttgagggagaacatgcttatgagatttatagctttctgtactgtccttctgttcctggtactctctgt |
312 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49277691 |
gaacctttttagccagtttaagattgagaggcttgagggagaacatgcttatgagatttatagctttctgtactgtccttctgttcctggtactctttgt |
49277592 |
T |
|
| Q |
313 |
gctcct |
318 |
Q |
| |
|
|||||| |
|
|
| T |
49277591 |
gctcct |
49277586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 76 - 318
Target Start/End: Complemental strand, 49271905 - 49271669
Alignment:
| Q |
76 |
tacattccaactctcactgatctcaccgttgagattccaatattgggtagtccttgcagtgagagaaaagtgtggaagatttcaaaagagggaactagag |
175 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||| || ||||||||||||||| ||| ||||||||||| | ||| ||| | || || | |
|
|
| T |
49271905 |
tacattccaactctcactgacctcaccattgagattcctattctgggtagtccttgcaatgaaccaaaagtgtggaggcttttaaaggttgggtctgg-- |
49271808 |
T |
|
| Q |
176 |
ctaggttttggtttgtgagcaccggtggttttcctgggaacctttttagccagttcaagattgagaggcttgagggagaacatgcttatgagatttatag |
275 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| | ||| ||||| ||||||||||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
49271807 |
----gttttggtttgtgagcactggtggtgcagctggggatcttgttagcaagttcaagattgagaggcttgcaggtgaacatgcttatgagatatatag |
49271712 |
T |
|
| Q |
276 |
ctttctgtactgtccttctgttcctggtactctctgtgctcct |
318 |
Q |
| |
|
|||| || |||||| |||||||||||| ||| ||||||||| |
|
|
| T |
49271711 |
ctttaagttctgtccctctgttcctggtgttctttgtgctcct |
49271669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University