View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9135_low_29 (Length: 328)
Name: NF9135_low_29
Description: NF9135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9135_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 5e-93; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 39905000 - 39905192
Alignment:
| Q |
1 |
ggtatgcaggggtgaaggtttcattggtggtgattgtcggggtgtccgtcaccgctgcttttgcaccaggaattgttgaaacaacgtacgcccaccaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
39905000 |
ggtatgcaggggtgaaggtttcattggtggtgattgtcggggtgtccgtcaccgctgcttttgcaccagaaattgttgaaacaacgtacgcccaccatgc |
39905099 |
T |
|
| Q |
101 |
tactaatgaataaatagctctaacttatgatagatacatgggctatcttagctagtgttatgcaacgatcatgtctatgatctttcatctcgt |
193 |
Q |
| |
|
| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39905100 |
ttctaatgaataaatagctctaactcatgatagatacatgggctagcttagctagtgttatgcaacgatcatgtctatgatctttcatctcgt |
39905192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 39901163 - 39901242
Alignment:
| Q |
1 |
ggtatgcaggggtgaaggtttcattggtggtgattgtcggggtgtccgtcaccgctgcttttgcaccaggaattgttgaa |
80 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||| || |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39901163 |
ggtatgcagaggtgaaggtttcactggtggtgattgtcgaggcttccgtcgccgctgcttttgcaccaggaattgttgaa |
39901242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 268 - 310
Target Start/End: Original strand, 39905234 - 39905276
Alignment:
| Q |
268 |
tatatctccatttctactaatagagctttcaaaatgtgccatg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39905234 |
tatatctccatttctactaatagagctttcaaaatgtgccatg |
39905276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University