View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9135_low_31 (Length: 316)
Name: NF9135_low_31
Description: NF9135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9135_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 26220314 - 26219999
Alignment:
| Q |
1 |
cccatgattttggaatggaagaggatgacgatgatctatttgaaattgatctagagagagtgaattgcattccaccactaccttataattatt------- |
93 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26220314 |
cccaagattttggaatggaagaggatgatgatgatctatttgaaattgatctagaggcagtgaattgcattccaccactaccttataattattgggaaag |
26220215 |
T |
|
| Q |
94 |
--------tcatttctacaggagaagctcttcttgcaaattgtttgctaccaatatcccatatttctagtgctgttccagcttgtaataatgcagtgtct |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26220214 |
taattatttcatttctacaggagaagctcttcttgcaaattgtttgctaccaatatcccatatttctagtgctgttccagcttgtaataatgcagtgtct |
26220115 |
T |
|
| Q |
186 |
tttggagagaacacaaatgctttcgttattacagaacctaaaccattgggggaatatcttaggttacctttcttgggagattttggatttataggtgaga |
285 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26220114 |
tttggagagaacacaaatgttttcgttattacagaacctaaaccattgggggaatatcttaggttacctttcttgggagattttggatttataggtgaga |
26220015 |
T |
|
| Q |
286 |
aaatgaaagcaaaatt |
301 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
26220014 |
aaatgaaagcaaaatt |
26219999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University