View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9135_low_36 (Length: 284)
Name: NF9135_low_36
Description: NF9135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9135_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 4 - 114
Target Start/End: Original strand, 28713291 - 28713401
Alignment:
| Q |
4 |
aacctccttcttaatactctccttctaagtcagcactcggctgcatcttaggggacccttatgttatgatatagtggaacagttgaagggtggtatgttg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28713291 |
aacctccttcttaatactctccttctaagtcagcactcggctgcatcttaggggacccttatgttatgatatagtggaacagttgaagggtggtatgttg |
28713390 |
T |
|
| Q |
104 |
gatggaggagt |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
28713391 |
gatggaggagt |
28713401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 181 - 260
Target Start/End: Original strand, 28713470 - 28713549
Alignment:
| Q |
181 |
ggacaggaaacaccattaatttcagggattgctgtggctgctgcagcttatgccgcaagatatagtatccaggcttggca |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28713470 |
ggacaggaaacaccattaatttcagggattgctgtggctgctgcagcttatgccgcaagatatagtatccagacttggca |
28713549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 191 - 260
Target Start/End: Complemental strand, 48904854 - 48904785
Alignment:
| Q |
191 |
caccattaatttcagggattgctgtggctgctgcagcttatgccgcaagatatagtatccaggcttggca |
260 |
Q |
| |
|
|||| |||||| | ||||||||||||||||||||||| ||||||| | |||| |||||||||||||||| |
|
|
| T |
48904854 |
cacctttaattgctgggattgctgtggctgctgcagcatatgccggtaaatatggtatccaggcttggca |
48904785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University