View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9135_low_37 (Length: 279)
Name: NF9135_low_37
Description: NF9135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9135_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 16 - 156
Target Start/End: Complemental strand, 161711 - 161574
Alignment:
| Q |
16 |
tctctgttgataattgttgcattaatggttatctctcaacatatgtaatgatttattactccttctttcttcttctgaagtacatgagaaactagcattg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
161711 |
tctctgttgataattgttgcattaatggttatctctcaacatatgtaatgatttattactccttctttc---ttctgaagtacatgagaaactagcattg |
161615 |
T |
 |
| Q |
116 |
atttactctactgatggtatgggttttatagacaaactatc |
156 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
161614 |
atttactctattgatggtatgggttttatagacaaactatc |
161574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 152 - 254
Target Start/End: Complemental strand, 161549 - 161447
Alignment:
| Q |
152 |
ctatctaatgtgttgtgtggaggttggaactttgcttcatgccattcgagattgtattcatgctaatttgttgtttttatattcatgttgtctttttggg |
251 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
161549 |
ctatctaatgtgttgtgtggaggttagaactttgcttcatgccattcgagactgtattcatgctaatttgttgtttttatattgatgttgtctttttggg |
161450 |
T |
 |
| Q |
252 |
ttt |
254 |
Q |
| |
|
||| |
|
|
| T |
161449 |
ttt |
161447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University