View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9135_low_40 (Length: 276)
Name: NF9135_low_40
Description: NF9135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9135_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 268
Target Start/End: Original strand, 2264245 - 2264495
Alignment:
| Q |
18 |
aattttaatgttaacaaaatttgtctgtaattgcttaaacgtttagaagtgtcaaaataaaatgaaatagtatatcagtcaaacaatagatatcttttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2264245 |
aattttaatgttaacaaaatttgtctgtaattgcttaaacgtttagaagtgtcaaaataaaatgaaatagtatatcagtcaaacaatagatatcttttga |
2264344 |
T |
|
| Q |
118 |
atatcttatttctaccggtatgtaacatataaactcgtttgtggtagctaaatatatattatcgagggatcgaataaaattatattttgggttaaccaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2264345 |
atatcttatttctaccggtatgtaacagataaactcgtttgtggtagctaaatatatattatcgagggatcgaataaaattatattttgggttaaccaaa |
2264444 |
T |
|
| Q |
218 |
gttactccatcgttacacataacttcaccattgcatatgagtcataaagga |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2264445 |
gttactccatcgttacacataacttcaccattgcatatgagtcataaagga |
2264495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University