View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9135_low_45 (Length: 247)
Name: NF9135_low_45
Description: NF9135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9135_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 21 - 230
Target Start/End: Original strand, 39090077 - 39090286
Alignment:
| Q |
21 |
aggtattgcttgtggatacacaaatccactacaaggaatagggaaatatgcaaggactattcacgagcctggttgtgcgaatgtggcatgcaatgatgat |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39090077 |
aggtattgcttgtggatacacaagtccactacaaggaatagggaaatatgcaaggactattcacgagcccggttgtgcgaatgtggcatgcaatgatgat |
39090176 |
T |
 |
| Q |
121 |
aaacaatttgggtcggctctaaatgcagcccgtcaagcggatgctactgttctagtgatgggattggatcagtcaattgaggctgaaatggtagatagga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39090177 |
aaacaatttgggtcggctctaaatgcagcccgtcaagcggatgctactgttctagtgatgggattggatcagtcaattgaggctgaaatggtagatagga |
39090276 |
T |
 |
| Q |
221 |
ctggtttact |
230 |
Q |
| |
|
|||||||||| |
|
|
| T |
39090277 |
ctggtttact |
39090286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University